Transcript: Human NR_148466.2

Homo sapiens ATP binding cassette subfamily D member 4 (ABCD4), transcript variant 26, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
ABCD4 (5826)
Length:
2843
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_148466.2
NBCI Gene record:
ABCD4 (5826)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_148466.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000059882 CACATGCAGATTCGGGTGAAT pLKO.1 693 3UTR 100% 4.950 6.930 N ABCD4 n/a
2 TRCN0000286572 CACATGCAGATTCGGGTGAAT pLKO_005 693 3UTR 100% 4.950 6.930 N ABCD4 n/a
3 TRCN0000059880 CCCAGGTTAGATCTGCAATTT pLKO.1 62 3UTR 100% 13.200 9.240 N ABCD4 n/a
4 TRCN0000293961 CTGATTACCTACAAATGATTT pLKO_005 1908 3UTR 100% 13.200 9.240 N ABCD4 n/a
5 TRCN0000298649 GTGAGCATCTTCGGGTATTTC pLKO_005 579 3UTR 100% 13.200 9.240 N ABCD4 n/a
6 TRCN0000059878 CCCTACCTTAACCCAAATGAA pLKO.1 2329 3UTR 100% 5.625 3.938 N ABCD4 n/a
7 TRCN0000059879 CGGCATCAACACCTTTGACTA pLKO.1 738 3UTR 100% 4.950 3.465 N ABCD4 n/a
8 TRCN0000286571 CGGCATCAACACCTTTGACTA pLKO_005 738 3UTR 100% 4.950 3.465 N ABCD4 n/a
9 TRCN0000059881 CCTTGAGAAGTTTCATTCCTT pLKO.1 1573 3UTR 100% 3.000 2.100 N ABCD4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_148466.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.