Transcript: Human NR_149105.1

Homo sapiens long intergenic non-protein coding RNA 2511 (LINC02511), long non-coding RNA.

Source:
NCBI, updated 2018-05-12
Taxon:
Homo sapiens (human)
Gene:
LINC02511 (105377441)
Length:
2488
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_149105.1
NBCI Gene record:
LINC02511 (105377441)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_149105.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000072628 CCTCCCAAAGTGCTAGGATTA pLKO.1 2186 3UTR 100% 10.800 5.400 Y MRPS16 n/a
2 TRCN0000165025 GTGCTAGGATTATAGGCGTGA pLKO.1 2195 3UTR 100% 2.160 1.080 Y LINC00336 n/a
3 TRCN0000140657 CCTCCCAAAGTGCTAGGATAA pLKO.1 2186 3UTR 100% 10.800 5.400 Y CD3EAP n/a
4 TRCN0000130146 CAGGTTCAAGTGATTCTCCTA pLKO.1 2026 3UTR 100% 2.640 1.320 Y DICER1-AS1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_149105.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.