Transcript: Human NR_152774.1

Homo sapiens WDFY3 antisense RNA 2 (WDFY3-AS2), transcript variant 5, long non-coding RNA.

Source:
NCBI, updated 2019-08-09
Taxon:
Homo sapiens (human)
Gene:
WDFY3-AS2 (404201)
Length:
3300
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_152774.1
NBCI Gene record:
WDFY3-AS2 (404201)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_152774.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000167626 GCTGTTTGAATCAGGAATAAT pLKO.1 1371 3UTR 100% 15.000 12.000 N WDFY3-AS2 n/a
2 TRCN0000167541 GCTGAGTTGAAATTCTACTAA pLKO.1 2529 3UTR 100% 5.625 4.500 N WDFY3-AS2 n/a
3 TRCN0000166992 CCAGACAAGAATATAGTCTAA pLKO.1 374 3UTR 100% 4.950 3.465 N WDFY3-AS2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_152774.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.