Transcript: Human NR_152867.1

Homo sapiens taurine up-regulated 1 (TUG1), transcript variant 4, long non-coding RNA.

Source:
NCBI, updated 2019-09-16
Taxon:
Homo sapiens (human)
Gene:
TUG1 (55000)
Length:
5260
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_152867.1
NBCI Gene record:
TUG1 (55000)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_152867.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000139979 GTGCTATTCCATCAGCCTACA pLKO.1 356 3UTR 100% 4.050 5.670 N TUG1 n/a
2 TRCN0000139468 CGAGATGATTCCTACCACCTT pLKO.1 400 3UTR 100% 2.640 3.696 N TUG1 n/a
3 TRCN0000144410 CCTCCATGAATACCTGAATTA pLKO.1 1622 3UTR 100% 13.200 10.560 N TUG1 n/a
4 TRCN0000140107 GACTACCTTCCCTGTGCTATT pLKO.1 343 3UTR 100% 10.800 8.640 N TUG1 n/a
5 TRCN0000144980 GCCAAATTCAAATACTGGCAA pLKO.1 1761 3UTR 100% 2.640 2.112 N TUG1 n/a
6 TRCN0000122359 CTACTGACGAAGACACCCATT pLKO.1 422 3UTR 100% 4.050 2.835 N TUG1 n/a
7 TRCN0000140935 CTGATTGCTGAGTGTTCACCT pLKO.1 313 3UTR 100% 2.640 1.848 N TUG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_152867.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.