Transcript: Human NR_156422.1

Homo sapiens ADAM like decysin 1 (ADAMDEC1), transcript variant 4, non-coding RNA.

Source:
NCBI, updated 2019-05-07
Taxon:
Homo sapiens (human)
Gene:
ADAMDEC1 (27299)
Length:
2273
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_156422.1
NBCI Gene record:
ADAMDEC1 (27299)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_156422.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000062304 CCTGAATTAACGCTCCATGAA pLKO.1 329 3UTR 100% 4.950 6.930 N ADAMDEC1 n/a
2 TRCN0000415701 TGTGAAGCCCTAACGTGTAAA pLKO_005 1559 3UTR 100% 13.200 10.560 N ADAMDEC1 n/a
3 TRCN0000430416 ACTCAAGCAATAGCCATAAAG pLKO_005 302 3UTR 100% 13.200 9.240 N ADAMDEC1 n/a
4 TRCN0000062307 CCTGTACTTTGGCTCATTGTT pLKO.1 278 3UTR 100% 5.625 3.938 N ADAMDEC1 n/a
5 TRCN0000062305 GCAAGCACCTATTCCTACAAA pLKO.1 1447 3UTR 100% 5.625 3.938 N ADAMDEC1 n/a
6 TRCN0000062303 GCCAGACTACACTGAAACATT pLKO.1 517 3UTR 100% 5.625 3.938 N ADAMDEC1 n/a
7 TRCN0000062306 GATGTGATGAACCTACTCAAT pLKO.1 959 3UTR 100% 4.950 3.465 N ADAMDEC1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_156422.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.