Transcript: Human NR_156689.1

Homo sapiens long intergenic non-protein coding RNA 1145 (LINC01145), transcript variant 6, long non-coding RNA.

Source:
NCBI, updated 2018-06-10
Taxon:
Homo sapiens (human)
Gene:
LINC01145 (103091866)
Length:
5646
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_156689.1
NBCI Gene record:
LINC01145 (103091866)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_156689.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000166843 CAGAAACGTAATAGGAATCAA pLKO.1 4878 3UTR 100% 5.625 3.938 N LINC02591 n/a
2 TRCN0000168869 CCACCTTCTTCAGAAACGTAA pLKO.1 4868 3UTR 100% 4.950 3.465 N LINC02591 n/a
3 TRCN0000172727 GAAGACAGAAGACCACAGTGT pLKO.1 4795 3UTR 100% 2.640 1.584 N LINC02591 n/a
4 TRCN0000172953 GCCAGCCAGATCAACGTAAAT pLKO.1 5493 3UTR 100% 13.200 6.600 Y LINC02591 n/a
5 TRCN0000168297 GCTATGCACTTGATTGCCTTT pLKO.1 5294 3UTR 100% 4.050 2.025 Y LINC02591 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_156689.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.