Transcript: Mouse NR_157571.1

Mus musculus transient receptor potential cation channel, subfamily M, member 6 (Trpm6), transcript variant 2, non-coding RNA.

Source:
NCBI, updated 2019-03-25
Taxon:
Mus musculus (mouse)
Gene:
Trpm6 (225997)
Length:
6722
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_157571.1
NBCI Gene record:
Trpm6 (225997)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NR_157571.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000362157 GATACCTTCGGCACCATTAAT pLKO_005 551 3UTR 100% 15.000 21.000 N Trpm6 n/a
2 TRCN0000023947 CCGGAAATACAATAACAACAA pLKO.1 5928 3UTR 100% 4.950 6.930 N Trpm6 n/a
3 TRCN0000362010 CCGCAAAGCCATGCGAGTTAT pLKO_005 5616 3UTR 100% 13.200 10.560 N Trpm6 n/a
4 TRCN0000023945 GCCACAATTTAGTCAGGTGTT pLKO.1 411 3UTR 100% 4.050 3.240 N Trpm6 n/a
5 TRCN0000362070 CATAACTGTTGACACCTTAAA pLKO_005 3927 3UTR 100% 13.200 9.240 N Trpm6 n/a
6 TRCN0000023944 GCAGAGATAAAGCTCTCATTA pLKO.1 4877 3UTR 100% 13.200 9.240 N Trpm6 n/a
7 TRCN0000023946 CCTCCCTTTATCCTGCTGAAT pLKO.1 3586 3UTR 100% 4.950 3.465 N Trpm6 n/a
8 TRCN0000023948 GCCCTACAAATCCAAGGAGAA pLKO.1 2032 3UTR 100% 4.050 2.835 N Trpm6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_157571.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.