Transcript: Human NR_158973.1

Homo sapiens neurexin 3 (NRXN3), transcript variant 8, non-coding RNA.

Source:
NCBI, updated 2019-08-13
Taxon:
Homo sapiens (human)
Gene:
NRXN3 (9369)
Length:
13042
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_158973.1
NBCI Gene record:
NRXN3 (9369)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_158973.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000094192 GCTCTATTATGATGGTTTGAA pLKO.1 4812 3UTR 100% 5.625 4.500 N Nrxn3 n/a
2 TRCN0000063571 CGTTTGGAGTTCCACAACATT pLKO.1 3436 3UTR 100% 5.625 3.938 N NRXN3 n/a
3 TRCN0000063569 GCTGCCTTAAAGAGGTTGTTT pLKO.1 2225 3UTR 100% 5.625 3.938 N NRXN3 n/a
4 TRCN0000063568 CCCAGGATCTAATTTCAGAAT pLKO.1 7550 3UTR 100% 4.950 3.465 N NRXN3 n/a
5 TRCN0000063570 CGGGACAATAGTAACACTCAT pLKO.1 3898 3UTR 100% 4.950 3.465 N NRXN3 n/a
6 TRCN0000063572 CCAGGAAGATTCATGTGCCAA pLKO.1 4176 3UTR 100% 2.640 1.848 N NRXN3 n/a
7 TRCN0000140179 GCACCTCTTCTTCCAGTTCAA pLKO.1 3696 3UTR 100% 4.950 2.475 Y NRXN2 n/a
8 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 9759 3UTR 100% 5.625 2.813 Y KLHL30 n/a
9 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 9759 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_158973.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.