Transcript: Human NR_158981.1

Homo sapiens RAB GTPase activating protein 1 like (RABGAP1L), transcript variant 8, non-coding RNA.

Source:
NCBI, updated 2019-03-22
Taxon:
Homo sapiens (human)
Gene:
RABGAP1L (9910)
Length:
3131
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_158981.1
NBCI Gene record:
RABGAP1L (9910)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_158981.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000048392 CGTAATGAAGTAGAGGCTTTA pLKO.1 607 3UTR 100% 10.800 15.120 N RABGAP1L n/a
2 TRCN0000048390 CCAGCCAAACAAATAAGCCAT pLKO.1 449 3UTR 100% 2.640 3.696 N RABGAP1L n/a
3 TRCN0000296306 TCCAATCTATAAGGTGTTATT pLKO_005 753 3UTR 100% 13.200 10.560 N RABGAP1L n/a
4 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 2118 3UTR 100% 5.625 2.813 Y KLHL30 n/a
5 TRCN0000157407 GATCTCGGCTTACTGCAACTT pLKO.1 1925 3UTR 100% 4.950 2.475 Y GTF2IRD2B n/a
6 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 2118 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_158981.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.