Transcript: Human NR_160025.1

Homo sapiens Rho GTPase activating protein 21 (ARHGAP21), transcript variant 15, non-coding RNA.

Source:
NCBI, updated 2018-12-29
Taxon:
Homo sapiens (human)
Gene:
ARHGAP21 (57584)
Length:
6613
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_160025.1
NBCI Gene record:
ARHGAP21 (57584)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_160025.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000154948 GCACATAGGTTGTCGGACAAT pLKO.1 789 3UTR 100% 4.950 6.930 N ARHGAP21 n/a
2 TRCN0000153502 CCTGACCAAATAAACGGAGAA pLKO.1 5690 3UTR 100% 4.050 5.670 N ARHGAP21 n/a
3 TRCN0000150338 CTTGTGAAAGTCCGAAGTAAT pLKO.1 1438 3UTR 100% 13.200 9.240 N ARHGAP21 n/a
4 TRCN0000156175 CCTCACAACTTCAGCTCCATT pLKO.1 2118 3UTR 100% 4.950 3.465 N ARHGAP21 n/a
5 TRCN0000151310 GATACTAAAGAGGAGTCCAAA pLKO.1 4295 3UTR 100% 4.950 3.465 N ARHGAP21 n/a
6 TRCN0000150898 GCAAGGTATTTGTTGCAACTT pLKO.1 6039 3UTR 100% 4.950 3.465 N ARHGAP21 n/a
7 TRCN0000154410 GCAGAGTTTCATCCCTGTCTT pLKO.1 5792 3UTR 100% 4.950 3.465 N ARHGAP21 n/a
8 TRCN0000154949 GCATCTCAAAGCACGACAGAT pLKO.1 838 3UTR 100% 4.950 3.465 N ARHGAP21 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_160025.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.