Transcript: Human NR_160664.1

Homo sapiens methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1 like pseudogene (LOC100996643), transcript variant 1, non-coding RNA.

Source:
NCBI, updated 2019-01-29
Taxon:
Homo sapiens (human)
Gene:
LOC100996643 (100996643)
Length:
1280
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_160664.1
NBCI Gene record:
LOC100996643 (100996643)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_160664.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000036591 GCTGTCTATGGAGCCAAAGAT pLKO.1 687 3UTR 100% 5.625 2.813 Y LOC389737 n/a
2 TRCN0000036590 GTGGACAAGATAAGGACCATT pLKO.1 660 3UTR 100% 4.950 2.475 Y LOC389737 n/a
3 TRCN0000036592 TCGTTACACTCAGCAGGGTTT pLKO.1 743 3UTR 100% 4.050 2.025 Y LOC389737 n/a
4 TRCN0000036593 GCCAAAGATATCGAACTCTGT pLKO.1 699 3UTR 100% 2.640 1.320 Y LOC389737 n/a
5 TRCN0000036589 GCATGGCAAAGACCGATCTTT pLKO.1 781 3UTR 100% 0.563 0.281 Y LOC389737 n/a
6 TRCN0000166364 CACACACACACACACACACAA pLKO.1 192 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_160664.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.