Transcript: Human NR_160670.1

Homo sapiens methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1 like pseudogene (LOC105379443), transcript variant 1, non-coding RNA.

Source:
NCBI, updated 2019-01-29
Taxon:
Homo sapiens (human)
Gene:
LOC105379443 (105379443)
Length:
1257
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_160670.1
NBCI Gene record:
LOC105379443 (105379443)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_160670.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000036591 GCTGTCTATGGAGCCAAAGAT pLKO.1 671 3UTR 100% 5.625 2.813 Y LOC389737 n/a
2 TRCN0000036590 GTGGACAAGATAAGGACCATT pLKO.1 644 3UTR 100% 4.950 2.475 Y LOC389737 n/a
3 TRCN0000036592 TCGTTACACTCAGCAGGGTTT pLKO.1 727 3UTR 100% 4.050 2.025 Y LOC389737 n/a
4 TRCN0000036593 GCCAAAGATATCGAACTCTGT pLKO.1 683 3UTR 100% 2.640 1.320 Y LOC389737 n/a
5 TRCN0000036589 GCATGGCAAAGACCGATCTTT pLKO.1 765 3UTR 100% 0.563 0.281 Y LOC389737 n/a
6 TRCN0000166364 CACACACACACACACACACAA pLKO.1 180 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_160670.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.