Transcript: Human NR_163251.1

Homo sapiens neuregulin 3 (NRG3), transcript variant 10, non-coding RNA.

Source:
NCBI, updated 2019-04-25
Taxon:
Homo sapiens (human)
Gene:
NRG3 (10718)
Length:
4012
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_163251.1
NBCI Gene record:
NRG3 (10718)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_163251.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000431215 CAGAACGAGAGGCGCAATTTG pLKO_005 2375 3UTR 100% 13.200 10.560 N NRG3 n/a
2 TRCN0000150772 GTAGGAATCTGTGCATTCTAT pLKO.1 2448 3UTR 100% 5.625 4.500 N NRG3 n/a
3 TRCN0000412992 GGGATAAAGCTTACCATTAAA pLKO_005 2624 3UTR 100% 15.000 10.500 N NRG3 n/a
4 TRCN0000150771 GACGTTGTCAATGTGAGTATT pLKO.1 2170 3UTR 100% 13.200 9.240 N NRG3 n/a
5 TRCN0000429384 ATATCAGCAACTCGAAGAATC pLKO_005 1875 3UTR 100% 10.800 7.560 N NRG3 n/a
6 TRCN0000065403 GCTGTCAATTTCATGTATCAT pLKO.1 1431 3UTR 100% 5.625 3.938 N Nrg3 n/a
7 TRCN0000151123 GCAGAACAACAAGAAGTGAAA pLKO.1 2212 3UTR 100% 4.950 3.465 N NRG3 n/a
8 TRCN0000155190 GAGAACTTGGTGAAGAGCCAT pLKO.1 1597 3UTR 100% 2.640 1.848 N NRG3 n/a
9 TRCN0000155516 GCTCAACAGGAAAGAGAGGAA pLKO.1 2474 3UTR 100% 2.640 1.848 N NRG3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_163251.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.