Transcript: Human NR_163556.1

Homo sapiens deleted in esophageal cancer 1 (DEC1), long non-coding RNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
DEC1 (50514)
Length:
1254
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_163556.1
NBCI Gene record:
DEC1 (50514)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_163556.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000359150 CCGTTTAGAATCATCTATTTA pLKO_005 903 3UTR 100% 15.000 21.000 N DEC1 n/a
2 TRCN0000078555 AGTCTGCTACAATGGAGGAAA pLKO.1 660 3UTR 100% 4.950 3.960 N DEC1 n/a
3 TRCN0000078557 TGTATCTCTTGCCAGGCCCAA pLKO.1 690 3UTR 100% 2.160 1.728 N DEC1 n/a
4 TRCN0000359217 GGCTTGTGCCTACGAAGATTA pLKO_005 958 3UTR 100% 13.200 9.240 N DEC1 n/a
5 TRCN0000078553 CCTACGAAGATTACTTAAGAA pLKO.1 966 3UTR 100% 5.625 3.938 N DEC1 n/a
6 TRCN0000359216 CCGTGTTACACATGATGGTTT pLKO_005 593 3UTR 100% 4.950 3.465 N DEC1 n/a
7 TRCN0000078554 GCCGTGTTACACATGATGGTT pLKO.1 592 3UTR 100% 3.000 2.100 N DEC1 n/a
8 TRCN0000078556 GAGAGGTCTGTAAAGTGGCAA pLKO.1 634 3UTR 100% 2.640 1.848 N DEC1 n/a
9 TRCN0000368647 GAGGGAATTGCAGATTGAATG pLKO_005 718 3UTR 100% 10.800 6.480 N DEC1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_163556.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.