Transcript: Human NR_163949.1

Homo sapiens SEM1 26S proteasome complex subunit (SEM1), transcript variant 7, non-coding RNA.

Source:
NCBI, updated 2019-07-13
Taxon:
Homo sapiens (human)
Gene:
SEM1 (7979)
Length:
2677
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_163949.1
NBCI Gene record:
SEM1 (7979)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_163949.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000172314 CCTTGGTGCACTGTGAAGATT pLKO.1 356 3UTR 100% 5.625 3.938 N n/a
2 TRCN0000167752 GCAACAGATAAACTTGGAGAT pLKO.1 252 3UTR 100% 4.050 2.835 N n/a
3 TRCN0000172902 GCTGTGTTTGCTGTACAAGGA pLKO.1 115 3UTR 100% 2.640 1.848 N n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_163949.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.