Transcript: Mouse NM_009869.1

Mus musculus cadherin 9 (Cdh9), mRNA.

Source:
NCBI, updated 2017-04-15
Taxon:
Mus musculus (mouse)
Gene:
Cdh9 (12565)
Length:
2903
CDS:
1..2367

Additional Resources:

NCBI RefSeq record:
NM_009869.1
NBCI Gene record:
Cdh9 (12565)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009869.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000254622 ACCCGGAATCAGGCATAATAA pLKO_005 629 CDS 100% 15.000 21.000 N Cdh9 n/a
2 TRCN0000254621 TACGTCTGTTATACAAGTAAC pLKO_005 522 CDS 100% 10.800 15.120 N Cdh9 n/a
3 TRCN0000254623 TTCGACAATGATTATCCTATT pLKO_005 1708 CDS 100% 10.800 15.120 N Cdh9 n/a
4 TRCN0000254619 CGTCATCCTGCTTACTCTAAT pLKO_005 1866 CDS 100% 13.200 10.560 N Cdh9 n/a
5 TRCN0000254620 TTCACCCTCTTTGCCTAATAA pLKO_005 2573 3UTR 100% 15.000 10.500 N Cdh9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009869.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05975 pDONR223 100% 86.4% 91.1% None (many diffs) n/a
2 ccsbBroad304_05975 pLX_304 0% 86.4% 91.1% V5 (many diffs) n/a
Download CSV