Transcript: Mouse XM_001004454.3

PREDICTED: Mus musculus predicted gene 14025 (Gm14025), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Gm14025 (668894)
Length:
9344
CDS:
4171..8412

Additional Resources:

NCBI RefSeq record:
XM_001004454.3
NBCI Gene record:
Gm14025 (668894)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_001004454.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000091829 CCAGGTCCAAAGGTTTGATAT pLKO.1 6024 CDS 100% 13.200 18.480 N Gm14025 n/a
2 TRCN0000091828 CCAGGAAATGACTAAACACTT pLKO.1 5661 CDS 100% 4.950 3.960 N Gm14025 n/a
3 TRCN0000091830 CCTCTGTGTCAACAACTATTT pLKO.1 6547 CDS 100% 13.200 9.240 N Gm14025 n/a
4 TRCN0000091832 GAGAACAGGAACCATCAAGTA pLKO.1 6256 CDS 100% 4.950 3.465 N Gm14025 n/a
5 TRCN0000091831 GCCAATGCTAGTGAGGAGTTT pLKO.1 4345 CDS 100% 4.950 3.465 N Gm14025 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_001004454.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.