Transcript: Human XM_005245041.3

PREDICTED: Homo sapiens calmodulin regulated spectrin associated protein family member 2 (CAMSAP2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CAMSAP2 (23271)
Length:
6259
CDS:
128..4549

Additional Resources:

NCBI RefSeq record:
XM_005245041.3
NBCI Gene record:
CAMSAP2 (23271)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005245041.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000364586 TTGTCAGATTAGAGGATATTT pLKO_005 933 CDS 100% 15.000 21.000 N CAMSAP2 n/a
2 TRCN0000364663 ATCGCTGAACACGGGTGATAA pLKO_005 3955 CDS 100% 13.200 18.480 N CAMSAP2 n/a
3 TRCN0000166929 CCAGGATATGTAACTCTTATA pLKO.1 6174 3UTR 100% 13.200 10.560 N CAMSAP2 n/a
4 TRCN0000369395 AGGTTCACCTGCTTGATATTA pLKO_005 4797 3UTR 100% 15.000 10.500 N CAMSAP2 n/a
5 TRCN0000364661 GCAAGTCACTGGCAGATATAA pLKO_005 2604 CDS 100% 15.000 10.500 N CAMSAP2 n/a
6 TRCN0000168227 CGAGGAATCACTCGTTCTATT pLKO.1 1448 CDS 100% 13.200 9.240 N CAMSAP2 n/a
7 TRCN0000369396 CTATGCTGCTTCATCCATAAA pLKO_005 1066 CDS 100% 13.200 9.240 N CAMSAP2 n/a
8 TRCN0000369318 GACATGGATGATGCATCTAAA pLKO_005 2027 CDS 100% 13.200 9.240 N CAMSAP2 n/a
9 TRCN0000167780 GCACCTTTCTTATGATGTTAA pLKO.1 5050 3UTR 100% 13.200 9.240 N CAMSAP2 n/a
10 TRCN0000167594 GCATTGAAGAAGCATTACAAA pLKO.1 1734 CDS 100% 5.625 3.938 N CAMSAP2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005245041.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.