Transcript: Human XM_005245421.1

PREDICTED: Homo sapiens arginyl aminopeptidase (RNPEP), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RNPEP (6051)
Length:
1927
CDS:
418..1500

Additional Resources:

NCBI RefSeq record:
XM_005245421.1
NBCI Gene record:
RNPEP (6051)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005245421.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000307289 ACCCGGACGACACCTATAATG pLKO_005 758 CDS 100% 13.200 10.560 N RNPEP n/a
2 TRCN0000294268 ATCAACTTCCTGGAGTTTATA pLKO_005 1582 3UTR 100% 15.000 10.500 N RNPEP n/a
3 TRCN0000051728 CCTGCTGTTAAATACAAGTAT pLKO.1 249 5UTR 100% 5.625 3.938 N RNPEP n/a
4 TRCN0000051730 GCTCCACAGCAATGTTGTCAA pLKO.1 1443 CDS 100% 4.950 3.465 N RNPEP n/a
5 TRCN0000051732 GCTCAATGAAGGTTTCACCAT pLKO.1 582 CDS 100% 2.640 1.848 N RNPEP n/a
6 TRCN0000286915 GCTCAATGAAGGTTTCACCAT pLKO_005 582 CDS 100% 2.640 1.848 N RNPEP n/a
7 TRCN0000051729 CCTGGATAAGATCCTCCAGAA pLKO.1 1161 CDS 100% 0.405 0.284 N RNPEP n/a
8 TRCN0000294267 GGACTTCTACTTGGAATATTT pLKO_005 915 CDS 100% 15.000 9.000 N RNPEP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005245421.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.