Transcript: Human XM_005245435.2

PREDICTED: Homo sapiens selectin P (SELP), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SELP (6403)
Length:
3262
CDS:
52..2544

Additional Resources:

NCBI RefSeq record:
XM_005245435.2
NBCI Gene record:
SELP (6403)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005245435.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000057534 CCCTGATCTCTGAACTAACAA pLKO.1 134 CDS 100% 5.625 7.875 N SELP n/a
2 TRCN0000057533 CCGATATAGTTCGGTGTGATA pLKO.1 1325 CDS 100% 4.950 6.930 N SELP n/a
3 TRCN0000057537 CCTCAATAAGGTCCTACCCTA pLKO.1 285 CDS 100% 2.640 3.696 N SELP n/a
4 TRCN0000057536 CCTTTGCTAAGCCCTCAGAAT pLKO.1 1585 CDS 100% 4.950 3.465 N SELP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005245435.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.