Transcript: Human XM_005245453.1

PREDICTED: Homo sapiens nuclear casein kinase and cyclin dependent kinase substrate 1 (NUCKS1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NUCKS1 (64710)
Length:
6063
CDS:
248..976

Additional Resources:

NCBI RefSeq record:
XM_005245453.1
NBCI Gene record:
NUCKS1 (64710)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005245453.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000082470 GTTGTTGATTACTCACAGTTT pLKO.1 275 CDS 100% 4.950 6.930 N NUCKS1 n/a
2 TRCN0000099348 CAGCGATGAAGATTTCCTAAT pLKO.1 637 CDS 100% 10.800 7.560 N Nucks1 n/a
3 TRCN0000332194 CAGCGATGAAGATTTCCTAAT pLKO_005 637 CDS 100% 10.800 7.560 N Nucks1 n/a
4 TRCN0000082471 CACTCAGCAGAGGATAGTGAA pLKO.1 467 CDS 100% 4.950 3.465 N NUCKS1 n/a
5 TRCN0000082469 CGGCATCTAAAGCAGCTTCTA pLKO.1 531 CDS 100% 4.950 3.465 N NUCKS1 n/a
6 TRCN0000197026 GAAGATAGTGAGGACTCAGAA pLKO.1 413 CDS 100% 4.950 3.465 N NUCKS1 n/a
7 TRCN0000196331 GATGATGACGATAGTGACTAT pLKO.1 662 CDS 100% 4.950 3.465 N NUCKS1 n/a
8 TRCN0000197253 GCAGTGAGGAAGAACAAGAAG pLKO.1 582 CDS 100% 4.950 3.465 N NUCKS1 n/a
9 TRCN0000197193 GCGATGAAGATTTCCTAATGG pLKO.1 639 CDS 100% 4.950 3.465 N NUCKS1 n/a
10 TRCN0000082472 CCAAACCCAGACTAAAGGCTA pLKO.1 753 CDS 100% 2.640 1.848 N NUCKS1 n/a
11 TRCN0000082468 CATTTCTCTCTCTCTCTCTTT pLKO.1 1134 3UTR 100% 4.950 2.475 Y NUCKS1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005245453.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.