Transcript: Human XM_005245817.1

PREDICTED: Homo sapiens transmembrane protein 50A (TMEM50A), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TMEM50A (23585)
Length:
2173
CDS:
137..517

Additional Resources:

NCBI RefSeq record:
XM_005245817.1
NBCI Gene record:
TMEM50A (23585)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005245817.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000275481 CCTCACTATAATTGGTATTTA pLKO_005 974 3UTR 100% 15.000 21.000 N TMEM50A n/a
2 TRCN0000275546 CATAGATGCAGCTGTTATTTA pLKO_005 253 CDS 100% 15.000 10.500 N TMEM50A n/a
3 TRCN0000128132 CCACAGTGCAATTCAGAATAT pLKO.1 1861 3UTR 100% 13.200 9.240 N TMEM50A n/a
4 TRCN0000275482 TGGACAAGTCCGAGGTGATAG pLKO_005 361 CDS 100% 10.800 7.560 N TMEM50A n/a
5 TRCN0000130207 CCACATGAACTCCTGATGTTT pLKO.1 1654 3UTR 100% 5.625 3.938 N TMEM50A n/a
6 TRCN0000146329 CGCAATACTATTGCTTCCATT pLKO.1 194 CDS 100% 4.950 3.465 N TMEM50A n/a
7 TRCN0000147720 GCCTTCCTAATGATTAATGCA pLKO.1 332 CDS 100% 3.000 2.100 N TMEM50A n/a
8 TRCN0000275480 GCCTTCCTAATGATTAATGCA pLKO_005 332 CDS 100% 3.000 2.100 N TMEM50A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005245817.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.