Transcript: Human XM_005245931.2

PREDICTED: Homo sapiens macoilin 1 (MACO1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MACO1 (55219)
Length:
2045
CDS:
203..1831

Additional Resources:

NCBI RefSeq record:
XM_005245931.2
NBCI Gene record:
MACO1 (55219)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005245931.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000139196 CGGAATCGGATCAGAGAACTA pLKO.1 1721 CDS 100% 4.950 6.930 N MACO1 n/a
2 TRCN0000344301 CGGAATCGGATCAGAGAACTA pLKO_005 1721 CDS 100% 4.950 6.930 N MACO1 n/a
3 TRCN0000140167 GCAGCCAAAGGATTACCTGAT pLKO.1 854 CDS 100% 4.050 5.670 N MACO1 n/a
4 TRCN0000344222 GCAGCCAAAGGATTACCTGAT pLKO_005 854 CDS 100% 4.050 5.670 N MACO1 n/a
5 TRCN0000145436 GATATGGATTCTTCGATCCTT pLKO.1 872 CDS 100% 3.000 4.200 N MACO1 n/a
6 TRCN0000122577 CGAAGTCATAGCGCCACAAAT pLKO.1 1202 CDS 100% 13.200 10.560 N MACO1 n/a
7 TRCN0000126371 CGTCTATGATTCCTTCAGATA pLKO.1 394 CDS 100% 4.950 3.960 N Tmem57 n/a
8 TRCN0000344224 GTGTAGCATTCACGTCAAATA pLKO_005 447 CDS 100% 13.200 9.240 N MACO1 n/a
9 TRCN0000122174 GAAGGTGAAAGAAGACCAAAT pLKO.1 1774 CDS 100% 10.800 7.560 N MACO1 n/a
10 TRCN0000140108 GAGAATCAAGCTGGACCTGTT pLKO.1 1994 3UTR 100% 4.050 2.835 N MACO1 n/a
11 TRCN0000140369 GCAGAATATCAGCCAGTTGGA pLKO.1 1552 CDS 100% 2.640 1.848 N MACO1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005245931.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.