Transcript: Human XM_005246107.3

PREDICTED: Homo sapiens diacylglycerol kinase delta (DGKD), transcript variant X9, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DGKD (8527)
Length:
5962
CDS:
16..3324

Additional Resources:

NCBI RefSeq record:
XM_005246107.3
NBCI Gene record:
DGKD (8527)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005246107.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000000674 CGCCTCGTGACCAAGTTTAAA pLKO.1 3031 CDS 100% 15.000 21.000 N DGKD n/a
2 TRCN0000231529 ATGGTTCACACATCGTGTAAA pLKO_005 496 CDS 100% 13.200 18.480 N DGKD n/a
3 TRCN0000231532 TAGAGTATTACACGGAGAAAT pLKO_005 1943 CDS 100% 13.200 18.480 N DGKD n/a
4 TRCN0000231531 CACCTCGGCTTACGGTTATTC pLKO_005 757 CDS 100% 13.200 10.560 N DGKD n/a
5 TRCN0000000671 CCAGTCTTGTTGATTGTAATT pLKO.1 3878 3UTR 100% 13.200 10.560 N DGKD n/a
6 TRCN0000196248 GCTCATCTTGTGTGCTGATAA pLKO.1 48 CDS 100% 13.200 10.560 N DGKD n/a
7 TRCN0000195008 CCAGAAACCCTAGAGTATTAC pLKO.1 1933 CDS 100% 13.200 9.240 N DGKD n/a
8 TRCN0000000672 GACAGCCTCAACCTTCATAAA pLKO.1 850 CDS 100% 13.200 9.240 N DGKD n/a
9 TRCN0000231533 TCCAGTCTTGTTGATTGTAAT pLKO_005 3877 3UTR 100% 13.200 9.240 N DGKD n/a
10 TRCN0000195253 CATCATTCGATGACAAGATTC pLKO.1 2273 CDS 100% 10.800 7.560 N DGKD n/a
11 TRCN0000000675 GAAGATTGGATTGCAGCATTA pLKO.1 82 CDS 100% 10.800 7.560 N DGKD n/a
12 TRCN0000000673 AGATCATAGAACACACAGAAA pLKO.1 1544 CDS 100% 4.950 3.465 N DGKD n/a
13 TRCN0000231530 CACTGTTGGTCTTCGTCAATT pLKO_005 641 CDS 100% 13.200 7.920 N DGKD n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005246107.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.