Transcript: Human XM_005247080.3

PREDICTED: Homo sapiens HERV-H LTR-associating 2 (HHLA2), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
HHLA2 (11148)
Length:
2536
CDS:
285..1529

Additional Resources:

NCBI RefSeq record:
XM_005247080.3
NBCI Gene record:
HHLA2 (11148)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005247080.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000137614 CGGTTGTATCAGGGTAACCAA pLKO.1 2018 3UTR 100% 3.000 4.200 N HHLA2 n/a
2 TRCN0000134880 CTTCCCATAACAAAGGCTTAT pLKO.1 1306 CDS 100% 10.800 7.560 N HHLA2 n/a
3 TRCN0000136483 CCAACTCGATTTGGGATGAAT pLKO.1 2035 3UTR 100% 5.625 3.938 N HHLA2 n/a
4 TRCN0000135009 CCACTAAGAATCTGGAAGAAA pLKO.1 1843 3UTR 100% 5.625 3.938 N HHLA2 n/a
5 TRCN0000138868 GCCAAGAAACAGCTTCCCATA pLKO.1 1294 CDS 100% 4.050 2.835 N HHLA2 n/a
6 TRCN0000135664 GCTTCCCATAACAAAGGCTTA pLKO.1 1305 CDS 100% 4.050 2.835 N HHLA2 n/a
7 TRCN0000136482 CCTGGATGTTAAGGATTCCAA pLKO.1 1748 3UTR 100% 3.000 2.100 N HHLA2 n/a
8 TRCN0000134144 CATATTCCCTTTGGCTTTCTT pLKO.1 350 CDS 100% 5.625 3.375 N HHLA2 n/a
9 TRCN0000138751 GCTCTTAACTTCACCGCCTAA pLKO.1 2407 3UTR 100% 4.050 2.025 Y HHLA2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005247080.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.