Transcript: Human XM_005247253.5

PREDICTED: Homo sapiens VPS8 subunit of CORVET complex (VPS8), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
VPS8 (23355)
Length:
3321
CDS:
172..3279

Additional Resources:

NCBI RefSeq record:
XM_005247253.5
NBCI Gene record:
VPS8 (23355)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005247253.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000381932 GGAGTGCCTTGAGCCATATAT pLKO_005 2019 CDS 100% 15.000 21.000 N Vps8 n/a
2 TRCN0000381468 GGTGCCTGTCATAGTTGATTA pLKO_005 1911 CDS 100% 13.200 9.240 N VPS8 n/a
3 TRCN0000380986 TGGTGACAGGACCAACTTAAA pLKO_005 501 CDS 100% 13.200 9.240 N VPS8 n/a
4 TRCN0000382144 TTCACTTCATGGATCAGTTAT pLKO_005 549 CDS 100% 13.200 9.240 N VPS8 n/a
5 TRCN0000116191 CCTCATCAACTTTACCTGGAT pLKO.1 1380 CDS 100% 2.640 1.848 N VPS8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005247253.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.