Transcript: Human XM_005247371.4

PREDICTED: Homo sapiens golgin B1 (GOLGB1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GOLGB1 (2804)
Length:
11687
CDS:
599..10408

Additional Resources:

NCBI RefSeq record:
XM_005247371.4
NBCI Gene record:
GOLGB1 (2804)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005247371.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000147838 GCAGGACAAATAAGTAAGGAA pLKO.1 3518 CDS 100% 3.000 2.400 N GOLGB1 n/a
2 TRCN0000146702 CCTCACAACTAGAAGATTCTT pLKO.1 9075 CDS 100% 5.625 3.938 N GOLGB1 n/a
3 TRCN0000147752 GCAGACAATCTCAAGTTGAAA pLKO.1 6899 CDS 100% 5.625 3.938 N GOLGB1 n/a
4 TRCN0000147531 GCAGGGATAATGAGAAATGAA pLKO.1 8684 CDS 100% 5.625 3.938 N GOLGB1 n/a
5 TRCN0000148716 CCGTAGCACTTGTAAAGGAAA pLKO.1 4023 CDS 100% 4.950 3.465 N GOLGB1 n/a
6 TRCN0000147839 GAAGGTACTTTAGGACTCTAT pLKO.1 8483 CDS 100% 4.950 3.465 N GOLGB1 n/a
7 TRCN0000147837 GCACTGAACATCAAAGTAGAA pLKO.1 2535 CDS 100% 4.950 3.465 N GOLGB1 n/a
8 TRCN0000147571 GCTTCTGCTTAATCTGAGAAT pLKO.1 10625 3UTR 100% 4.950 3.465 N GOLGB1 n/a
9 TRCN0000148998 GTCTTCCCATTTACAGGTCTT pLKO.1 10494 3UTR 100% 4.050 2.430 N GOLGB1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005247371.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.