Transcript: Human XM_005247552.2

PREDICTED: Homo sapiens kelch like family member 24 (KLHL24), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
KLHL24 (54800)
Length:
7380
CDS:
387..2189

Additional Resources:

NCBI RefSeq record:
XM_005247552.2
NBCI Gene record:
KLHL24 (54800)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005247552.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000151625 GAGCAACTTGATCCTTGTAAT pLKO.1 867 CDS 100% 13.200 18.480 N KLHL24 n/a
2 TRCN0000323134 GGACTGACCAAGGCAATATAC pLKO_005 1911 CDS 100% 13.200 18.480 N KLHL24 n/a
3 TRCN0000323130 TTTCGTGATAGCCGCTTATTC pLKO_005 561 CDS 100% 13.200 18.480 N KLHL24 n/a
4 TRCN0000150576 GCAGCGTAGAATGTTATGATT pLKO.1 1651 CDS 100% 5.625 4.500 N KLHL24 n/a
5 TRCN0000151100 GAAACCAATTCTTGGCTACTT pLKO.1 1818 CDS 100% 4.950 3.960 N KLHL24 n/a
6 TRCN0000257760 AGCCGTGATGTCTGGATTTAT pLKO_005 1506 CDS 100% 15.000 10.500 N Klhl24 n/a
7 TRCN0000323133 CCGTGATGTCTGGATTTATAA pLKO_005 1508 CDS 100% 15.000 10.500 N KLHL24 n/a
8 TRCN0000323132 GCATGACTTGAGGCATCATTT pLKO_005 2578 3UTR 100% 13.200 9.240 N KLHL24 n/a
9 TRCN0000323203 TGTTGCATCCCAACTACTTTG pLKO_005 1162 CDS 100% 10.800 7.560 N KLHL24 n/a
10 TRCN0000150844 GCTCTAAGGAATGACATTCTT pLKO.1 1464 CDS 100% 5.625 3.938 N KLHL24 n/a
11 TRCN0000151607 GCTGTGTGACTATTCATAGAT pLKO.1 2143 CDS 100% 5.625 3.938 N KLHL24 n/a
12 TRCN0000151071 GAGTGTTATCAGTTGTTGCAT pLKO.1 1224 CDS 100% 3.000 1.800 N KLHL24 n/a
13 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 6092 3UTR 100% 5.625 2.813 Y KLHL30 n/a
14 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 6092 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005247552.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.