Transcript: Human XM_005247703.2

PREDICTED: Homo sapiens transformer 2 beta homolog (TRA2B), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TRA2B (6434)
Length:
2281
CDS:
744..1310

Additional Resources:

NCBI RefSeq record:
XM_005247703.2
NBCI Gene record:
TRA2B (6434)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005247703.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000314919 TACTCACCTCGTCGCTATTAA pLKO_005 1290 CDS 100% 15.000 21.000 N TRA2B n/a
2 TRCN0000314918 ACTGTTGTCTTGGAGTATTTG pLKO_005 793 CDS 100% 13.200 9.240 N TRA2B n/a
3 TRCN0000314917 AGGTCTTACAGTCGAGATTAT pLKO_005 693 5UTR 100% 13.200 9.240 N TRA2B n/a
4 TRCN0000000118 ATACGCCAACACCAGGAATTT pLKO.1 1042 CDS 100% 13.200 9.240 N TRA2B n/a
5 TRCN0000314985 CATGAAACATACCATACTTAT pLKO_005 1785 3UTR 100% 13.200 9.240 N TRA2B n/a
6 TRCN0000000117 TGCCGATGTGTCTATTGTATA pLKO.1 875 CDS 100% 13.200 9.240 N TRA2B n/a
7 TRCN0000314984 TGCCGATGTGTCTATTGTATA pLKO_005 875 CDS 100% 13.200 9.240 N TRA2B n/a
8 TRCN0000000115 AGCAGGAAATACGAAGAGTTA pLKO.1 1947 3UTR 100% 4.950 3.465 N TRA2B n/a
9 TRCN0000000116 GAAGCTAAAGAACGTGCCAAT pLKO.1 963 CDS 100% 4.050 2.835 N TRA2B n/a
10 TRCN0000000119 TGGAGTATTTGGGCTGAGCTT pLKO.1 803 CDS 100% 2.640 1.848 N TRA2B n/a
11 TRCN0000109284 CTAAGAGAAGTGTTCTCTAAA pLKO.1 843 CDS 100% 1.320 0.924 N Tra2b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005247703.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.