Transcript: Human XM_005248292.4

PREDICTED: Homo sapiens drosha ribonuclease III (DROSHA), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DROSHA (29102)
Length:
4783
CDS:
403..4503

Additional Resources:

NCBI RefSeq record:
XM_005248292.4
NBCI Gene record:
DROSHA (29102)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005248292.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000022250 CGAAGCTCTTTGGTGAATAAT pLKO.1 3910 CDS 100% 15.000 21.000 N DROSHA n/a
2 TRCN0000280338 CGAAGCTCTTTGGTGAATAAT pLKO_005 3910 CDS 100% 15.000 21.000 N DROSHA n/a
3 TRCN0000280339 CGCGAAGTCTGGCTCAATTAT pLKO_005 3601 CDS 100% 15.000 21.000 N DROSHA n/a
4 TRCN0000022252 CCAGCGTCCATTTGTACTATT pLKO.1 3317 CDS 100% 13.200 18.480 N DROSHA n/a
5 TRCN0000280274 CCAGCGTCCATTTGTACTATT pLKO_005 3317 CDS 100% 13.200 18.480 N DROSHA n/a
6 TRCN0000022249 GAGTATTTACTTGCTCAGTAA pLKO.1 4523 3UTR 100% 0.495 0.396 N DROSHA n/a
7 TRCN0000280336 GAGTATTTACTTGCTCAGTAA pLKO_005 4523 3UTR 100% 0.495 0.396 N DROSHA n/a
8 TRCN0000022251 CCAGTGCTAATAACAGCAGTA pLKO.1 983 CDS 100% 4.050 2.835 N DROSHA n/a
9 TRCN0000022253 GCCAGATGAGACTGAAGACAT pLKO.1 4473 CDS 100% 4.950 2.970 N DROSHA n/a
10 TRCN0000280273 GCCAGATGAGACTGAAGACAT pLKO_005 4473 CDS 100% 4.950 2.970 N DROSHA n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005248292.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.