Transcript: Human XM_005248337.3

PREDICTED: Homo sapiens alanine--glyoxylate aminotransferase 2 (AGXT2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
AGXT2 (64902)
Length:
2458
CDS:
297..1838

Additional Resources:

NCBI RefSeq record:
XM_005248337.3
NBCI Gene record:
AGXT2 (64902)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005248337.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000035193 CCTGAAAGATACCAGTCCCTT pLKO.1 456 CDS 100% 2.640 2.112 N AGXT2 n/a
2 TRCN0000035190 GCTGTGCTTGAGGTGATTAAA pLKO.1 1470 CDS 100% 15.000 10.500 N AGXT2 n/a
3 TRCN0000035189 GCCAAGCTAAAGATCAGTATA pLKO.1 1069 CDS 100% 13.200 9.240 N AGXT2 n/a
4 TRCN0000435619 CCCTTTGCAGTGATTGGTTTA pLKO_005 2104 3UTR 100% 10.800 7.560 N AGXT2 n/a
5 TRCN0000035192 GCATAGAAATGGTGCAGGATA pLKO.1 1609 CDS 100% 4.950 3.465 N AGXT2 n/a
6 TRCN0000035191 GCCCTCAATGTGCATCACTAA pLKO.1 1745 CDS 100% 4.950 2.970 N AGXT2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005248337.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.