Transcript: Human XM_005249143.3

PREDICTED: Homo sapiens methylmalonyl-CoA mutase (MMUT), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MMUT (4594)
Length:
2873
CDS:
171..2423

Additional Resources:

NCBI RefSeq record:
XM_005249143.3
NBCI Gene record:
MMUT (4594)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005249143.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000336827 TGCTATCAAGAGGGTTCATAA pLKO_005 1967 CDS 100% 13.200 18.480 N MMUT n/a
2 TRCN0000049038 CCTGGTGTCATGCTATAAGTA pLKO.1 2568 3UTR 100% 5.625 4.500 N MMUT n/a
3 TRCN0000327914 CCTGGTGTCATGCTATAAGTA pLKO_005 2568 3UTR 100% 5.625 4.500 N MMUT n/a
4 TRCN0000049040 GCCCGAAGACAAGCTAGAATA pLKO.1 1587 CDS 100% 13.200 9.240 N MMUT n/a
5 TRCN0000327912 GCCCGAAGACAAGCTAGAATA pLKO_005 1587 CDS 100% 13.200 9.240 N MMUT n/a
6 TRCN0000049041 CCCTTGTATTCCAAGAGAGAT pLKO.1 381 CDS 100% 4.950 3.465 N MMUT n/a
7 TRCN0000327911 CCCTTGTATTCCAAGAGAGAT pLKO_005 381 CDS 100% 4.950 3.465 N MMUT n/a
8 TRCN0000178133 GCTACAGGATTTGCTGATCTT pLKO.1 2073 CDS 100% 4.950 3.465 N Mut n/a
9 TRCN0000049039 GCAGGGATTATCAGTTGCCTT pLKO.1 563 CDS 100% 2.640 1.848 N MMUT n/a
10 TRCN0000049042 GCTGTAGAAGTTCTGGCAATT pLKO.1 1665 CDS 100% 10.800 6.480 N MMUT n/a
11 TRCN0000327913 GCTGTAGAAGTTCTGGCAATT pLKO_005 1665 CDS 100% 10.800 6.480 N MMUT n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005249143.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.