Transcript: Human XM_005249539.1

PREDICTED: Homo sapiens PAX interacting protein 1 (PAXIP1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PAXIP1 (22976)
Length:
3851
CDS:
285..3392

Additional Resources:

NCBI RefSeq record:
XM_005249539.1
NBCI Gene record:
PAXIP1 (22976)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005249539.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000248336 GACATCGACCCGCAGGTTATT pLKO_005 86 5UTR 100% 13.200 18.480 N Paxip1 n/a
2 TRCN0000322957 GACATCGACCCGCAGGTTATT pLKO_005 86 5UTR 100% 13.200 18.480 N PAXIP1 n/a
3 TRCN0000128479 GTGTTTGCAATTGCGGATTAT pLKO.1 2010 CDS 100% 13.200 18.480 N PAXIP1 n/a
4 TRCN0000322818 GTGTTTGCAATTGCGGATTAT pLKO_005 2010 CDS 100% 13.200 18.480 N PAXIP1 n/a
5 TRCN0000147635 GCACATATCTTACAGACTCTT pLKO.1 1251 CDS 100% 4.950 6.930 N PAXIP1 n/a
6 TRCN0000129174 CTTCAGATTCATCACCGGAAA pLKO.1 937 CDS 100% 4.050 3.240 N PAXIP1 n/a
7 TRCN0000322817 CTTCAGATTCATCACCGGAAA pLKO_005 937 CDS 100% 4.050 3.240 N PAXIP1 n/a
8 TRCN0000322819 GCCATGTTCACAGCATATTAT pLKO_005 2294 CDS 100% 15.000 10.500 N PAXIP1 n/a
9 TRCN0000322883 TACGGGACTTCAACTAGAAAT pLKO_005 3679 3UTR 100% 13.200 9.240 N PAXIP1 n/a
10 TRCN0000147957 GCCAAATATACGGGTTATCTA pLKO.1 2379 CDS 100% 5.625 3.938 N PAXIP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005249539.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.