Transcript: Human XM_005249665.4

PREDICTED: Homo sapiens HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1 (HECW1), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
HECW1 (23072)
Length:
9246
CDS:
348..5171

Additional Resources:

NCBI RefSeq record:
XM_005249665.4
NBCI Gene record:
HECW1 (23072)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005249665.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000010637 GCCTAGACATACGGTGCAAAT pLKO.1 5780 3UTR 100% 10.800 15.120 N HECW1 n/a
2 TRCN0000010638 GACCTAAATGACTGGCGGAAT pLKO.1 4821 CDS 100% 4.050 5.670 N HECW1 n/a
3 TRCN0000001523 GACCTCACTTTCACTGTTAAT pLKO.1 4560 CDS 100% 13.200 9.240 N HECW1 n/a
4 TRCN0000010639 CCGGGACTTGGTGAATTTCAT pLKO.1 3359 CDS 100% 5.625 3.938 N HECW1 n/a
5 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 6852 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005249665.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.