Transcript: Human XM_005250108.1

PREDICTED: Homo sapiens leucine rich repeat containing 17 (LRRC17), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LRRC17 (10234)
Length:
2568
CDS:
806..2131

Additional Resources:

NCBI RefSeq record:
XM_005250108.1
NBCI Gene record:
LRRC17 (10234)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005250108.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000243111 CTTGAGCTACCTGCGTCTTTA pLKO_005 1267 CDS 100% 13.200 18.480 N LRRC17 n/a
2 TRCN0000166997 GCGTATTAGAAGACTTGTATT pLKO.1 1806 CDS 100% 13.200 18.480 N LRRC17 n/a
3 TRCN0000243112 ATTAACTGTGTTGCCTATTTA pLKO_005 2205 3UTR 100% 15.000 10.500 N LRRC17 n/a
4 TRCN0000243110 CTTGACTTGTCATACAATAAA pLKO_005 1622 CDS 100% 15.000 10.500 N LRRC17 n/a
5 TRCN0000172319 CCGTGTGACGTGTACACATAT pLKO.1 962 CDS 100% 13.200 9.240 N LRRC17 n/a
6 TRCN0000243113 TGACGGAGGAAGTGTTCATTT pLKO_005 1236 CDS 100% 13.200 9.240 N LRRC17 n/a
7 TRCN0000167520 GAACAGTTGTGTAATGAAGAA pLKO.1 1430 CDS 100% 4.950 3.465 N LRRC17 n/a
8 TRCN0000243114 GTGAGATAGAAACGCTTATTT pLKO_005 1311 CDS 100% 15.000 9.000 N LRRC17 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005250108.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.