Transcript: Human XM_005250707.5

PREDICTED: Homo sapiens calcium dependent secretion activator 2 (CADPS2), transcript variant X15, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CADPS2 (93664)
Length:
4708
CDS:
164..3940

Additional Resources:

NCBI RefSeq record:
XM_005250707.5
NBCI Gene record:
CADPS2 (93664)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005250707.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000163078 GCAACGCAGTTCGGAGTTATT pLKO.1 591 CDS 100% 13.200 18.480 N CADPS2 n/a
2 TRCN0000430687 ATGAGTACTGTGCCCGTTATG pLKO_005 2196 CDS 100% 10.800 15.120 N CADPS2 n/a
3 TRCN0000160329 CCAACTTCTAATAGCTCCAAA pLKO.1 1511 CDS 100% 4.950 6.930 N CADPS2 n/a
4 TRCN0000429286 GATCTGGCAGACACCTATATT pLKO_005 3566 CDS 100% 15.000 12.000 N CADPS2 n/a
5 TRCN0000161358 GCTGAATTACACCGAATGGTA pLKO.1 1535 CDS 100% 3.000 2.400 N CADPS2 n/a
6 TRCN0000161143 CGTTCACAGAACTCTGCATTT pLKO.1 1178 CDS 100% 10.800 7.560 N CADPS2 n/a
7 TRCN0000159596 GCACTGCAAATGTTTGTCTTT pLKO.1 3086 CDS 100% 4.950 3.465 N CADPS2 n/a
8 TRCN0000158964 GCATTTGAACTCAAGCTACAA pLKO.1 3209 CDS 100% 4.950 3.465 N CADPS2 n/a
9 TRCN0000119995 GCTCCATTACAGCTTTGCATT pLKO.1 2302 CDS 100% 4.950 3.465 N Cadps2 n/a
10 TRCN0000161289 GCTCCATTACAGCTTTGCATT pLKO.1 2302 CDS 100% 4.950 3.465 N CADPS2 n/a
11 TRCN0000161315 GCAGTTACTGAAAGAACGGTT pLKO.1 520 CDS 100% 2.640 1.848 N CADPS2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005250707.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.