Transcript: Human XM_005250757.3

PREDICTED: Homo sapiens KH RNA binding domain containing, signal transduction associated 3 (KHDRBS3), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
KHDRBS3 (10656)
Length:
1659
CDS:
181..1137

Additional Resources:

NCBI RefSeq record:
XM_005250757.3
NBCI Gene record:
KHDRBS3 (10656)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005250757.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000154463 GTGGACTAACTCAAGACACAA pLKO.1 1056 CDS 100% 4.950 6.930 N KHDRBS3 n/a
2 TRCN0000428439 TGGTGCTGATTACTATGATTA pLKO_005 987 CDS 100% 13.200 10.560 N KHDRBS3 n/a
3 TRCN0000416794 GTTCCTCATCCCTGATTATAA pLKO_005 555 CDS 100% 15.000 10.500 N KHDRBS3 n/a
4 TRCN0000420882 TACATCGATGTGGTGATTAAT pLKO_005 229 CDS 100% 15.000 10.500 N KHDRBS3 n/a
5 TRCN0000417271 ATCTGAATGGATGGAACTTAA pLKO_005 1247 3UTR 100% 13.200 9.240 N KHDRBS3 n/a
6 TRCN0000155459 GATGGATATGGCACTGCTTAT pLKO.1 913 CDS 100% 10.800 7.560 N KHDRBS3 n/a
7 TRCN0000154552 GAAAGGTTCCATGAGAGACAA pLKO.1 393 CDS 100% 4.950 3.465 N KHDRBS3 n/a
8 TRCN0000156167 CAAGGAAGAAGAGTTGAGGAA pLKO.1 417 CDS 100% 2.640 1.848 N KHDRBS3 n/a
9 TRCN0000156580 GTGGCAATTCTCTGAAGCGTT pLKO.1 335 CDS 100% 2.640 1.848 N KHDRBS3 n/a
10 TRCN0000154551 GCTGGGACAGAAAGTGTTAAT pLKO.1 261 CDS 100% 13.200 7.920 N KHDRBS3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005250757.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.