Transcript: Human XM_005251728.2

PREDICTED: Homo sapiens tubulin tyrosine ligase like 11 (TTLL11), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TTLL11 (158135)
Length:
8805
CDS:
459..1892

Additional Resources:

NCBI RefSeq record:
XM_005251728.2
NBCI Gene record:
TTLL11 (158135)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005251728.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000417137 CCGGTCAAGTGAACAAGTTTC pLKO_005 429 5UTR 100% 10.800 15.120 N TTLL11 n/a
2 TRCN0000426418 GAGTTTCATTTCACGACAATG pLKO_005 399 5UTR 100% 10.800 15.120 N TTLL11 n/a
3 TRCN0000251531 TACTGGCATGGAGTTTCATTT pLKO_005 389 5UTR 100% 13.200 10.560 N Ttll11 n/a
4 TRCN0000146721 CCTGAGAACATCGTGTTTATT pLKO.1 2312 3UTR 100% 15.000 10.500 N TTLL11 n/a
5 TRCN0000419648 ATCATCTCCGTGGTGATTAAG pLKO_005 924 CDS 100% 13.200 9.240 N TTLL11 n/a
6 TRCN0000147091 CTTATCGACAAGCTCAAGTTT pLKO.1 627 CDS 100% 5.625 3.938 N TTLL11 n/a
7 TRCN0000148537 CACCGCATCTTTATGCACTTA pLKO.1 765 CDS 100% 4.950 3.465 N TTLL11 n/a
8 TRCN0000147864 GCTCAAGTTTGATATTCGTCT pLKO.1 638 CDS 100% 2.640 1.848 N TTLL11 n/a
9 TRCN0000148156 GTATGTCTTACTCAAGTCCTT pLKO.1 659 CDS 100% 2.640 1.848 N TTLL11 n/a
10 TRCN0000149393 GCCTGAGAACATCGTGTTTAT pLKO.1 2311 3UTR 100% 13.200 7.920 N TTLL11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005251728.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.