Transcript: Human XM_005251918.5

PREDICTED: Homo sapiens nuclear receptor subfamily 6 group A member 1 (NR6A1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NR6A1 (2649)
Length:
8849
CDS:
2103..3419

Additional Resources:

NCBI RefSeq record:
XM_005251918.5
NBCI Gene record:
NR6A1 (2649)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005251918.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000019741 CGAGGAGTATGCTTGCATGAA pLKO.1 3134 CDS 100% 4.950 6.930 N NR6A1 n/a
2 TRCN0000019743 CGAGCTCTCAATCAAGGATTA pLKO.1 2903 CDS 100% 10.800 8.640 N NR6A1 n/a
3 TRCN0000019740 GCCTCCACATTACCAATATAT pLKO.1 2633 CDS 100% 15.000 10.500 N NR6A1 n/a
4 TRCN0000420827 AGTACTGCCGCCTGCTCAAAT pLKO_005 2314 CDS 100% 13.200 9.240 N NR6A1 n/a
5 TRCN0000421494 AGCGGAGCATTTGCAACAAAC pLKO_005 2230 CDS 100% 10.800 7.560 N NR6A1 n/a
6 TRCN0000425856 CATTGGGCCAGTCCAGATATC pLKO_005 2402 CDS 100% 10.800 7.560 N NR6A1 n/a
7 TRCN0000426250 GCTGTCTTCCCTCACCGTTTA pLKO_005 2963 CDS 100% 10.800 7.560 N NR6A1 n/a
8 TRCN0000019742 CCTGATCTCATGATGTGCTTA pLKO.1 3288 CDS 100% 4.950 3.465 N NR6A1 n/a
9 TRCN0000019739 CGGAAGGCTATCAGAGAAGAT pLKO.1 2355 CDS 100% 4.950 2.970 N NR6A1 n/a
10 TRCN0000026036 CCAGTAGGTCTGTGGAACTAA pLKO.1 2569 CDS 100% 5.625 4.500 N Nr6a1 n/a
11 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 6463 3UTR 100% 5.625 2.813 Y KLHL30 n/a
12 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 6463 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005251918.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.