Transcript: Human XM_005251980.5

PREDICTED: Homo sapiens protein prenyltransferase alpha subunit repeat containing 1 (PTAR1), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PTAR1 (375743)
Length:
897
CDS:
73..795

Additional Resources:

NCBI RefSeq record:
XM_005251980.5
NBCI Gene record:
PTAR1 (375743)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005251980.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000437992 GGGTGCTACAACAGCTAATTC pLKO_005 506 CDS 100% 13.200 18.480 N PTAR1 n/a
2 TRCN0000436494 GACTCCCTAGGCCTAGAAATG pLKO_005 854 3UTR 100% 10.800 15.120 N PTAR1 n/a
3 TRCN0000036385 CGCCTTAACCAAGTTTCCAAA pLKO.1 456 CDS 100% 4.950 6.930 N PTAR1 n/a
4 TRCN0000036386 GCGACTCATACAAGAAGAGAT pLKO.1 594 CDS 100% 4.950 6.930 N PTAR1 n/a
5 TRCN0000416553 AGATACCCAAGCAACTATAAT pLKO_005 640 CDS 100% 15.000 10.500 N PTAR1 n/a
6 TRCN0000431950 ATGTCCTGAAGCTAGGTATAA pLKO_005 180 CDS 100% 13.200 9.240 N PTAR1 n/a
7 TRCN0000367088 TCTACCTTCAGCATCACTTAA pLKO_005 726 CDS 100% 13.200 9.240 N Ptar1 n/a
8 TRCN0000421157 ACTCTAGCAAGCAAGGCTATT pLKO_005 795 CDS 100% 10.800 7.560 N PTAR1 n/a
9 TRCN0000414937 TCTGGCACTTTAAATCCAATT pLKO_005 412 CDS 100% 10.800 7.560 N PTAR1 n/a
10 TRCN0000036388 CATAGATGAAATTGGCCTGAT pLKO.1 156 CDS 100% 4.050 2.835 N PTAR1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005251980.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.