Transcript: Human XM_005252571.4

PREDICTED: Homo sapiens supervillin (SVIL), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SVIL (6840)
Length:
8127
CDS:
448..7218

Additional Resources:

NCBI RefSeq record:
XM_005252571.4
NBCI Gene record:
SVIL (6840)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005252571.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000116713 CCGAGTATTTATCCCGCTATA pLKO.1 836 CDS 100% 10.800 15.120 N SVIL n/a
2 TRCN0000116715 CGATCCAAATACTGCACAGAA pLKO.1 661 CDS 100% 4.950 6.930 N SVIL n/a
3 TRCN0000420306 GCACCAGGGAAATGGATATAT pLKO_005 7267 3UTR 100% 15.000 10.500 N SVIL n/a
4 TRCN0000412909 GACAGCCATAAGGAATCTAAA pLKO_005 3403 CDS 100% 13.200 9.240 N SVIL n/a
5 TRCN0000417382 AGAATCCATGTGCGATGTTTG pLKO_005 3740 CDS 100% 10.800 7.560 N SVIL n/a
6 TRCN0000116712 GCCACCAATATGTATCTTCAT pLKO.1 7732 3UTR 100% 4.950 3.465 N SVIL n/a
7 TRCN0000116714 GCTACTTATATCCAAACCATT pLKO.1 5110 CDS 100% 4.950 3.465 N SVIL n/a
8 TRCN0000116716 CAAACCATTGAAGAAGGAATT pLKO.1 5122 CDS 100% 0.000 0.000 N SVIL n/a
9 TRCN0000418310 GCCTCAGAACTTGCAACTTTA pLKO_005 5059 CDS 100% 13.200 7.920 N SVIL n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005252571.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.