Transcript: Human XM_005252646.2

PREDICTED: Homo sapiens sperm associated antigen 6 (SPAG6), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SPAG6 (9576)
Length:
2429
CDS:
152..1507

Additional Resources:

NCBI RefSeq record:
XM_005252646.2
NBCI Gene record:
SPAG6 (9576)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005252646.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000141485 CGTCACTTTCCCAAGTTTCAA pLKO.1 2276 3UTR 100% 5.625 3.938 N SPAG6 n/a
2 TRCN0000140399 GAACCTAGCAATGGCAGTCAT pLKO.1 952 CDS 100% 4.950 3.465 N SPAG6 n/a
3 TRCN0000141994 GCAAAGCATTCTCCAGAGTTA pLKO.1 734 CDS 100% 4.950 3.465 N SPAG6 n/a
4 TRCN0000142537 GCTCTGCTCATGAATGAACAA pLKO.1 2221 3UTR 100% 4.950 3.465 N SPAG6 n/a
5 TRCN0000140874 GCTGTTGTGAAGTGCGACATT pLKO.1 383 CDS 100% 4.950 3.465 N SPAG6 n/a
6 TRCN0000140440 GCAGCTCATTCTGAGAACCTA pLKO.1 938 CDS 100% 3.000 2.100 N SPAG6 n/a
7 TRCN0000144823 GCCATAAAGAATATCCTGCAA pLKO.1 1184 CDS 100% 2.640 1.848 N SPAG6 n/a
8 TRCN0000141866 GCCTGGGCACTTAGATATATT pLKO.1 587 CDS 100% 15.000 9.000 N SPAG6 n/a
9 TRCN0000250350 TGTATCCAGGAGCCAGAAATT pLKO_005 674 CDS 100% 13.200 7.920 N Spag6l n/a
10 TRCN0000142213 GCAGTCACAAATACTTTGCCA pLKO.1 1100 CDS 100% 0.750 0.450 N SPAG6 n/a
11 TRCN0000144056 CCTGATGCTAAATTGAAGCAT pLKO.1 812 CDS 100% 0.300 0.210 N SPAG6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005252646.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.