Transcript: Human XM_005253027.3

PREDICTED: Homo sapiens PHD and ring finger domains 1 (PHRF1), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PHRF1 (57661)
Length:
5509
CDS:
124..5064

Additional Resources:

NCBI RefSeq record:
XM_005253027.3
NBCI Gene record:
PHRF1 (57661)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005253027.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000359826 CAGTTGATCGAACTCTATTTA pLKO_005 551 CDS 100% 15.000 21.000 N PHRF1 n/a
2 TRCN0000359824 ACGACCTGGACCTGGATTATG pLKO_005 3878 CDS 100% 13.200 18.480 N PHRF1 n/a
3 TRCN0000074344 CGGACACGTCTTTGATGATTT pLKO.1 3915 CDS 100% 13.200 18.480 N PHRF1 n/a
4 TRCN0000074345 CGAGCTCAATTTGGTGGTAAA pLKO.1 586 CDS 100% 10.800 15.120 N PHRF1 n/a
5 TRCN0000359825 TTGAGAGCTTCCGGATCAATA pLKO_005 2435 CDS 100% 13.200 9.240 N PHRF1 n/a
6 TRCN0000074347 GCTACCCAGGATACCAAAGAT pLKO.1 2148 CDS 100% 5.625 3.938 N PHRF1 n/a
7 TRCN0000074346 GCACTATGAGAGTAGGAAGAA pLKO.1 3420 CDS 100% 4.950 3.465 N PHRF1 n/a
8 TRCN0000074343 CCTGTGTTGCTCACAGTTGAA pLKO.1 5250 3UTR 100% 0.495 0.347 N PHRF1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005253027.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.