Transcript: Human XM_005253288.4

PREDICTED: Homo sapiens ATP binding cassette subfamily C member 9 (ABCC9), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ABCC9 (10060)
Length:
8977
CDS:
685..5334

Additional Resources:

NCBI RefSeq record:
XM_005253288.4
NBCI Gene record:
ABCC9 (10060)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005253288.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000425827 GGCGTGATTCTGCTCTATAAT pLKO_005 2014 CDS 100% 15.000 21.000 N ABCC9 n/a
2 TRCN0000431110 TTGCGCCAATTCAGTACTTTA pLKO_005 2081 CDS 100% 13.200 18.480 N ABCC9 n/a
3 TRCN0000059276 GCAGTGGGAAATCATCGTTAT pLKO.1 4730 CDS 100% 10.800 15.120 N ABCC9 n/a
4 TRCN0000059273 CGGGCCATGTATTCAAGAGAA pLKO.1 3499 CDS 100% 4.950 6.930 N ABCC9 n/a
5 TRCN0000059274 CGTGTGAATGAAACCCAGAAT pLKO.1 1654 CDS 100% 4.950 3.465 N ABCC9 n/a
6 TRCN0000059275 GCCAGTGGAAACAATCTGAAA pLKO.1 2365 CDS 100% 4.950 3.465 N ABCC9 n/a
7 TRCN0000059277 GCTGTGGAGATCAATGTCATT pLKO.1 1228 CDS 100% 4.950 3.465 N ABCC9 n/a
8 TRCN0000151984 CCAGTTAGAATGGCAATCATT pLKO.1 8016 3UTR 100% 5.625 2.813 Y LOC340211 n/a
9 TRCN0000136053 GAAGAAGAGGAGGAAGATGAA pLKO.1 3553 CDS 100% 4.950 2.475 Y GRWD1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005253288.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.