Transcript: Human XM_005253358.5

PREDICTED: Homo sapiens potassium inwardly rectifying channel subfamily J member 8 (KCNJ8), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
KCNJ8 (3764)
Length:
1772
CDS:
316..1590

Additional Resources:

NCBI RefSeq record:
XM_005253358.5
NBCI Gene record:
KCNJ8 (3764)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005253358.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000044430 CCCAATCGAGAGCAATAACAT pLKO.1 1071 CDS 100% 5.625 7.875 N KCNJ8 n/a
2 TRCN0000289108 CCCAATCGAGAGCAATAACAT pLKO_005 1071 CDS 100% 5.625 7.875 N KCNJ8 n/a
3 TRCN0000044429 GCAGTCATGTTAGGCTGCATT pLKO.1 826 CDS 100% 4.950 6.930 N KCNJ8 n/a
4 TRCN0000296216 CAGCACTTTCTGTAGTAATAA pLKO_005 1729 3UTR 100% 15.000 10.500 N KCNJ8 n/a
5 TRCN0000296165 AGACTTGGAGGTCATAGTTAT pLKO_005 1179 CDS 100% 13.200 9.240 N KCNJ8 n/a
6 TRCN0000308085 TGATCATCTGCCACGTGATTG pLKO_005 1109 CDS 100% 10.800 7.560 N KCNJ8 n/a
7 TRCN0000044431 GTGCAATTTATGACTCCAGAA pLKO.1 1543 CDS 100% 4.050 2.835 N KCNJ8 n/a
8 TRCN0000289159 GTGCAATTTATGACTCCAGAA pLKO_005 1543 CDS 100% 4.050 2.835 N KCNJ8 n/a
9 TRCN0000044432 CATAAGAACATCCGTGAGCAA pLKO.1 454 CDS 100% 2.640 1.848 N KCNJ8 n/a
10 TRCN0000069842 CATCTATGCTTACATGGAGAA pLKO.1 615 CDS 100% 4.050 2.430 N Kcnj8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005253358.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.