Transcript: Human XM_005254137.4

PREDICTED: Homo sapiens ADAM metallopeptidase with thrombospondin type 1 motif 7 (ADAMTS7), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ADAMTS7 (11173)
Length:
5706
CDS:
257..5326

Additional Resources:

NCBI RefSeq record:
XM_005254137.4
NBCI Gene record:
ADAMTS7 (11173)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005254137.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000438120 CCGTGTTCTCCTGGCATTATG pLKO_005 2718 CDS 100% 13.200 18.480 N ADAMTS7 n/a
2 TRCN0000415139 TGGCGTCCTCTATGATGTAAG pLKO_005 1648 CDS 100% 10.800 7.560 N ADAMTS7 n/a
3 TRCN0000051235 CGTTGGGAAACGACCTTTCAT pLKO.1 1477 CDS 100% 5.625 3.938 N ADAMTS7 n/a
4 TRCN0000420137 CAATTTCCACGAGGATCTGTC pLKO_005 3466 CDS 100% 4.050 2.835 N ADAMTS7 n/a
5 TRCN0000437558 TGTAAGAACGTGGGCTGTGAC pLKO_005 2261 CDS 100% 4.050 2.835 N ADAMTS7 n/a
6 TRCN0000051236 CCCGCCTTCTACGAGCTACAA pLKO.1 491 CDS 100% 1.650 1.155 N ADAMTS7 n/a
7 TRCN0000051237 GCGCCTGGTCAAGTGTGTCAA pLKO.1 5029 CDS 100% 1.650 1.155 N ADAMTS7 n/a
8 TRCN0000051234 GCCCAAATACAAAGGCAGATA pLKO.1 1963 CDS 100% 4.950 2.970 N ADAMTS7 n/a
9 TRCN0000433088 GTATATCACCAGGTTCCTTGA pLKO_005 1558 CDS 100% 4.050 2.430 N ADAMTS7 n/a
10 TRCN0000051233 CCGGAGAAGTACTTCCTCAAT pLKO.1 2486 CDS 100% 4.950 2.475 Y ADAMTS7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005254137.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.