Transcript: Human XM_005254252.3

PREDICTED: Homo sapiens MAX dimerization protein MGA (MGA), transcript variant X11, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MGA (23269)
Length:
11087
CDS:
178..9048

Additional Resources:

NCBI RefSeq record:
XM_005254252.3
NBCI Gene record:
MGA (23269)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005254252.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000237938 TGTTCGACATTACCCATTATG pLKO_005 3636 CDS 100% 13.200 18.480 N MGA n/a
2 TRCN0000237941 CTAGCCCTGAGAACCATAATA pLKO_005 3992 CDS 100% 15.000 12.000 N MGA n/a
3 TRCN0000237939 GGCACCTGTTGTGGCTAAATT pLKO_005 8988 CDS 100% 15.000 10.500 N MGA n/a
4 TRCN0000237942 TATAGCAGTTTCCCGTTATTT pLKO_005 10912 3UTR 100% 15.000 10.500 N MGA n/a
5 TRCN0000237940 CCCACTAAGAGTACCAGTTAT pLKO_005 2749 CDS 100% 13.200 9.240 N MGA n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005254252.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.