Transcript: Human XM_005255228.4

PREDICTED: Homo sapiens calcium regulated heat stable protein 1 (CARHSP1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CARHSP1 (23589)
Length:
2882
CDS:
156..662

Additional Resources:

NCBI RefSeq record:
XM_005255228.4
NBCI Gene record:
CARHSP1 (23589)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005255228.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000342942 TGAGACCTGGTCTGGACATGT pLKO_005 629 CDS 100% 4.950 3.960 N CARHSP1 n/a
2 TRCN0000019208 CCATCAAGCTTCAGTCGGGCT pLKO.1 257 CDS 100% 0.180 0.144 N CARHSP1 n/a
3 TRCN0000352798 GGCGACGAGGTCACCTATAAA pLKO_005 528 CDS 100% 15.000 10.500 N CARHSP1 n/a
4 TRCN0000369314 TGACTTCTCCAAGGCAAATTT pLKO_005 1093 3UTR 100% 15.000 10.500 N CARHSP1 n/a
5 TRCN0000352796 CCAAGGGCCATGGCTTCATTA pLKO_005 436 CDS 100% 13.200 9.240 N CARHSP1 n/a
6 TRCN0000343006 TCTACAAAGGAGTCTGCAAAT pLKO_005 403 CDS 100% 10.800 7.560 N CARHSP1 n/a
7 TRCN0000019204 GTCTACAAAGGAGTCTGCAAA pLKO.1 402 CDS 100% 4.950 3.465 N CARHSP1 n/a
8 TRCN0000369389 TCCATCCCACCCAAGAATGAG pLKO_005 555 CDS 100% 4.950 3.465 N CARHSP1 n/a
9 TRCN0000019207 GACATCTTCCTGCACATCTCT pLKO.1 477 CDS 100% 3.000 2.100 N CARHSP1 n/a
10 TRCN0000019205 GAAGGCGACGAGGTCACCTAT pLKO.1 525 CDS 100% 1.650 1.155 N CARHSP1 n/a
11 TRCN0000377282 TCCTAGGAGATGGTGGAAGCA pLKO_005 657 CDS 100% 2.640 1.584 N CARHSP1 n/a
12 TRCN0000077369 CCGTCTACAAAGGAGTCTGTA pLKO.1 400 CDS 100% 4.950 6.930 N Carhsp1 n/a
13 TRCN0000301438 CCGTCTACAAAGGAGTCTGTA pLKO_005 400 CDS 100% 4.950 6.930 N Carhsp1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005255228.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07911 pDONR223 100% 87.1% 87.5% None 1_63del;168G>C;303T>C n/a
2 ccsbBroad304_07911 pLX_304 0% 87.1% 87.5% V5 1_63del;168G>C;303T>C n/a
Download CSV