Transcript: Human XM_005255370.3

PREDICTED: Homo sapiens polycystin 1, transient receptor potential channel interacting (PKD1), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PKD1 (5310)
Length:
11727
CDS:
842..10708

Additional Resources:

NCBI RefSeq record:
XM_005255370.3
NBCI Gene record:
PKD1 (5310)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001149544 GCGGCCCTCCAAGTACACGT pXPR_003 AGG 4114 42% 6 1.143 PKD1 PKD1 76841
2 BRDN0001148399 GTTGGTGCCATCCCTAACCA pXPR_003 CGG 1921 19% 4 0.9824 PKD1 PKD1 76842
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005255370.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000062322 GTCCGTCTTTGGCAAGACATT pLKO.1 9832 CDS 100% 0.495 0.347 N PKD1 n/a
2 TRCN0000062319 GCCATTTACCACCCATAGCTT pLKO.1 3088 CDS 100% 3.000 1.800 N PKD1 n/a
3 TRCN0000417410 TGACCGTGCTGGCATCTAATG pLKO_005 1104 CDS 100% 10.800 5.400 Y PKD1 n/a
4 TRCN0000062320 CGAGGAGTTCTGTGTCTACAA pLKO.1 5362 CDS 100% 4.950 2.475 Y PKD1 n/a
5 TRCN0000062318 GCTTTGTGTTTGTCGTGTCAT pLKO.1 4482 CDS 100% 4.950 2.475 Y PKD1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005255370.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.