Transcript: Human XM_005256093.4

PREDICTED: Homo sapiens terminal nucleotidyltransferase 4B (TENT4B), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TENT4B (64282)
Length:
2383
CDS:
30..2051

Additional Resources:

NCBI RefSeq record:
XM_005256093.4
NBCI Gene record:
TENT4B (64282)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005256093.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000049375 GCCACATATAGAGATTGGATA pLKO.1 1533 CDS 100% 4.950 6.930 N TENT4B n/a
2 TRCN0000049373 CCAACAAATCTCAGCATGGAT pLKO.1 1939 CDS 100% 3.000 4.200 N TENT4B n/a
3 TRCN0000049374 CCCAATACAAACTATGGTGTT pLKO.1 1182 CDS 100% 4.050 2.835 N TENT4B n/a
4 TRCN0000049376 GCCTTTGATTATGCCTACGTT pLKO.1 1416 CDS 100% 3.000 2.100 N TENT4B n/a
5 TRCN0000049377 CGATGTTGGAAGGAGTTCATA pLKO.1 1373 CDS 100% 5.625 3.375 N TENT4B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005256093.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.